Regulon of HrcA in Thermotogales bacterium TBF 19.5.1

Properties
Regulator type:	Transcription factor
TF locus tag:	Kole_1384
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermotogales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 50 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6.3 Sequence: TTAGCAGACTCATATAAAGAGTGCTAA Locus tag: Kole_1626 Name: groS Funciton: GroES chaperonin Locus tag: Kole_1627 Name: groL Funciton: GroEL chaperonin
	Kole_1626	groS	GroES chaperonin
	Kole_1627	groL	GroEL chaperonin
Position: -82 Score: 5.6 Sequence: ATGGCAAACTTGACATTCGATTGCTAA Locus tag: Kole_0886 Name: dnaK Funciton: Chaperone Hsp70 Locus tag: Kole_0885 Name: hsp20 Funciton: Chaperone Hsp20 Locus tag: Kole_0884 Name: clpB Funciton: Chaperone protein
	Kole_0886	dnaK	Chaperone Hsp70
	Kole_0885	hsp20	Chaperone Hsp20
	Kole_0884	clpB	Chaperone protein
Position: -28 Score: 5.6 Sequence: TTAGCAGTCTCCAGGGAGGAGTGCTAA Locus tag: Kole_1384 Name: hrcA Funciton: Heat shock response regulator, HrcA family Locus tag: Kole_1385 Name: grpE Funciton: Heat shock protein Locus tag: Kole_1386 Name: dnaJ Funciton: Chaperone Hsp40
	Kole_1384	hrcA	Heat shock response regulator, HrcA family
	Kole_1385	grpE	Heat shock protein
	Kole_1386	dnaJ	Chaperone Hsp40

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD