Regulon of HrcA in Petrotoga mobilis SJ95

Properties
Regulator type:	Transcription factor
TF locus tag:	Pmob_1823
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermotogales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 50 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 6.9 Sequence: TTAGCACTCTTAATATTTGATTGCTAA Locus tag: Pmob_1157 Name: groS Funciton: GroES chaperonin Locus tag: Pmob_1158 Name: groL Funciton: GroEL chaperonin
	Pmob_1157	groS	GroES chaperonin
	Pmob_1158	groL	GroEL chaperonin
Position: -28 Score: 5.8 Sequence: TTAGCACTTAATATGCGGGAGTGATAA Locus tag: Pmob_1823 Name: hrcA Funciton: Heat shock response regulator, HrcA family Locus tag: Pmob_1824 Name: grpE Funciton: Heat shock protein Locus tag: Pmob_1825 Name: dnaJ Funciton: Chaperone Hsp40
	Pmob_1823	hrcA	Heat shock response regulator, HrcA family
	Pmob_1824	grpE	Heat shock protein
	Pmob_1825	dnaJ	Chaperone Hsp40
Position: -205 Score: 5.7 Sequence: TTTTCACTCTTAGATTAAGAGTGATAT Locus tag: Pmob_1649 Name: dnaK Funciton: Chaperone Hsp70 Locus tag: Pmob_1650 Name: hsp20 Funciton: Chaperone Hsp20
	Pmob_1649	dnaK	Chaperone Hsp70
	Pmob_1650	hsp20	Chaperone Hsp20
Position: -68 Score: 6.3 Sequence: TTAGCAAATAAAAGTAACGAGTGATAA Locus tag: Pmob_1629 Name: clpA Funciton: Chaperone protein
	Pmob_1629	clpA	Chaperone protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD