Regulon of HrcA in Thermosipho melanesiensis BI429

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmel_0089
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermotogales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 50 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 6.3 Sequence: TTATCAGTCTATATATGTGACTGATAA Locus tag: Tmel_0413 Name: clpA Funciton: Chaperone protein
	Tmel_0413	clpA	Chaperone protein
Position: -54 Score: 5.8 Sequence: TTAGCAGTCGATGATTAAGAGTGACAA Locus tag: Tmel_0053 Name: groS Funciton: GroES chaperonin Locus tag: Tmel_0052 Name: groL Funciton: GroEL chaperonin
	Tmel_0053	groS	GroES chaperonin
	Tmel_0052	groL	GroEL chaperonin
Position: -51 Score: 6.1 Sequence: TTATCAGACATAGCATAAGAGTGATAA Locus tag: Tmel_0089 Name: hrcA Funciton: Heat shock response regulator, HrcA family Locus tag: Tmel_0088 Name: grpE Funciton: Heat shock protein Locus tag: Tmel_0087 Name: dnaJ Funciton: Chaperone Hsp40
	Tmel_0089	hrcA	Heat shock response regulator, HrcA family
	Tmel_0088	grpE	Heat shock protein
	Tmel_0087	dnaJ	Chaperone Hsp40
Position: -157 Score: 5.6 Sequence: ATAACAAACGAATGTTACGATTGCTAT Position: -57 Score: 6.5 Sequence: TTATCACTCTTGACAATAGAGTGATAA Locus tag: Tmel_1128 Name: dnaK Funciton: Chaperone Hsp70 Locus tag: Tmel_1127 Name: hsp20 Funciton: Chaperone Hsp20
	Tmel_1128	dnaK	Chaperone Hsp70
	Tmel_1127	hsp20	Chaperone Hsp20

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD