Regulon of HrcA in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_1782
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Thermotogales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 50 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -169 Score: 5.9 Sequence: GTATCAGTCTATAATTACGAGTGCTAT Locus tag: Tlet_0014 Name: dnaK Funciton: Chaperone Hsp70 Locus tag: Tlet_0015 Name: hsp20 Funciton: Chaperone Hsp20 Locus tag: Tlet_0016 Name: clpB Funciton: Chaperone protein
	Tlet_0014	dnaK	Chaperone Hsp70
	Tlet_0015	hsp20	Chaperone Hsp20
	Tlet_0016	clpB	Chaperone protein
Position: -29 Score: 6.8 Sequence: TTAGCACTCAAATGATGAGAGTGATAA Locus tag: Tlet_1782 Name: hrcA Funciton: Heat shock response regulator, HrcA family Locus tag: Tlet_1781 Name: grpE Funciton: Heat shock protein Locus tag: Tlet_1780 Name: dnaJ Funciton: Chaperone Hsp40
	Tlet_1782	hrcA	Heat shock response regulator, HrcA family
	Tlet_1781	grpE	Heat shock protein
	Tlet_1780	dnaJ	Chaperone Hsp40
Position: -57 Score: 6.5 Sequence: TTAGCACTCAAACAGTTCGAGTGATAA Locus tag: Tlet_0318 Name: groS Funciton: GroES chaperonin Locus tag: Tlet_0317 Name: groL Funciton: GroEL chaperonin
	Tlet_0318	groS	GroES chaperonin
	Tlet_0317	groL	GroEL chaperonin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD