Regulon of RbkR in Pyrococcus horikoshii OT3

Properties
Regulator type:	Transcription factor
TF locus tag:	PH0660
Regulator family:	[Other]
Regulation mode:
Biological process:	Riboflavin biosynthesis
Effector:	Flavin mononucleotide
Regulog:	RbkR - Thermococcales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Thermococcales
By trascription factor - RbkR
By TF family - [Other]
By effector - Flavin mononucleotide
By pathway - Riboflavin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 6.2 Sequence: TTGTTCCAATTATAGAACAT Locus tag: PH0251 Name: ribU Funciton: Substrate-specific component RibU of riboflavin ECF transporter
	PH0251	ribU	Substrate-specific component RibU of riboflavin ECF transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD