Regulon of RbkR in Pyrococcus horikoshii OT3
| Regulator type: | Transcription factor |
| TF locus tag: | PH0660 |
| Regulator family: | [Other] |
| Regulation mode: | |
| Biological process: | Riboflavin biosynthesis |
| Effector: | Flavin mononucleotide |
| Regulog: | RbkR - Thermococcales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermococcales
- By trascription factor - RbkR
- By TF family - [Other]
- By effector - Flavin mononucleotide
- By pathway - Riboflavin biosynthesis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -62
Score: 6.2 Sequence: TTGTTCCAATTATAGAACAT
Locus tag: PH0251
Name: ribU Funciton: Substrate-specific component RibU of riboflavin ECF transporter |
|||
|
ribU
|
Substrate-specific component RibU of riboflavin ECF transporter
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |