Regulon of PhrR in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VCA0056
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Heat shock; Adenosylcobalamin
Regulog:	PhrR - Vibrionales
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - PhrR
By TF family - MerR
By effector - Heat shock
By effector - Adenosylcobalamin
By pathway - Light-dependent DNA repair

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 6.7 Sequence: TGTACAAAAAAAATATTTGTACA Position: -28 Score: 5.8 Sequence: TGTACAGAAATTTTCATTGTATA Locus tag: VCA0055 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: VCA0056 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: VCA0057 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: VCA0058 Name: ykuD Funciton: L,D-transpeptidase catalytic domain
	VCA0055	COG3272	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
	VCA0056	phrR	Transcriptional regulator, MerR family, associated with photolyase
	VCA0057	phr	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
	VCA0058	ykuD	L,D-transpeptidase catalytic domain
Position: -32 Score: 5.6 Sequence: TATACGAATCTTAAATTTGTATA Locus tag: VC1118 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VC1119 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VC1120 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VC1121 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VC1122 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VC1123 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: VC1124 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: VC1125 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
	VC1118	PF07366	Protein of unknown function DUF1486
	VC1119	PF00106	Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
	VC1120	PF01593	Flavin containing amine oxidoreductase
	VC1121	PF07103	Protein of unknown function DUF1365
	VC1122	PF02353	S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
	VC1123	PF11086	Protein of unknown function DUF2878
	VC1124	FIG026291	FIG026291: Hypothetical periplasmic protein
	VC1125	FIG002577	FIG002577: Putative lipoprotein precursor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD