Regulon of PhrR in Vibrio angustum S14

Properties
Regulator type:	Transcription factor
TF locus tag:	VAS14_11864
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Heat shock; Adenosylcobalamin
Regulog:	PhrR - Vibrionales
Statistics of regulated genes:
- Genes	12
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - PhrR
By TF family - MerR
By effector - Heat shock
By effector - Adenosylcobalamin
By pathway - Light-dependent DNA repair

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 6.2 Sequence: TATACAATAAAAAAACTTGTACA Locus tag: VAS14_11844 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: VAS14_11849 Name: VAS14_11849 Funciton: hypothetical protein Locus tag: VAS14_11854 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: VAS14_11859 Name: metY Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48) Locus tag: VAS14_11864 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: VAS14_11869 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: VAS14_11874 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VAS14_11879 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VAS14_11884 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VAS14_11889 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VAS14_11894 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VAS14_11899 Name: PF11086 Funciton: Protein of unknown function DUF2878
	VAS14_11844	COG3272	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
	VAS14_11849	VAS14_11849	hypothetical protein
	VAS14_11854	COG3272	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
	VAS14_11859	metY	O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
	VAS14_11864	phrR	Transcriptional regulator, MerR family, associated with photolyase
	VAS14_11869	phr	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
	VAS14_11874	PF07366	Protein of unknown function DUF1486
	VAS14_11879	PF00106	Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
	VAS14_11884	PF01593	Flavin containing amine oxidoreductase
	VAS14_11889	PF07103	Protein of unknown function DUF1365
	VAS14_11894	PF02353	S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
	VAS14_11899	PF11086	Protein of unknown function DUF2878

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD