Regulon of PhsR in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_02672
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	PhsR - Vibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - PhsR
By TF family - LuxR
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -215 Score: 7.3 Sequence: ATTATTGTGGGAAACCACAATATC Locus tag: VIBHAR_02674 Name: sirA Funciton: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit
	VIBHAR_02674	sirA	Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit
Position: -1904 Score: 7.2 Sequence: GATATTGTGGTTTCCCACAATAAT Locus tag: VIBHAR_02672 Name: phsR Funciton: Thiosulfate reduction response regulator protein PhsR, LuxR family
	VIBHAR_02672	phsR	Thiosulfate reduction response regulator protein PhsR, LuxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD