Statistics of regulated genes

Genome	Genes	Operons
Photobacterium profundum SS9
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio fischeri ES114	6	2
Vibrio harveyi ATCC BAA-1116	2	2
Vibrio parahaemolyticus RIMD 2210633	6	2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes											Function
CRON 1.
phsS	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio fischeri ES114 Site: position = -212 score = 7.49854 sequence = ACTATTGTGGTAAACCACAATAAT Gene: VF_A0102: Thiosulfate reduction sensor protein PhsS	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -225 score = 7.28224 sequence = GGTATTGTGGTTTCCCACAATAAT Gene: VP1201: Thiosulfate reduction sensor protein PhsS	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Thiosulfate reduction sensor protein PhsS
phsR	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114 Gene: VF_A0103: Thiosulfate reduction response regulator protein PhsR, LuxR family	* Vibrio harveyi ATCC BAA-1116 Site: position = -1904 score = 7.20502 sequence = GATATTGTGGTTTCCCACAATAAT Gene: VIBHAR_02672: Thiosulfate reduction response regulator protein PhsR, LuxR family	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1202: Thiosulfate reduction response regulator protein PhsR, LuxR family	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Thiosulfate reduction response regulator protein PhsR, LuxR family
CRON 2.
sirA	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio fischeri ES114 Site: position = -224 score = 7.49854 sequence = ATTATTGTGGTTTACCACAATAGT Gene: VF_A0101: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit	* Vibrio harveyi ATCC BAA-1116 Site: position = -215 score = 7.28224 sequence = ATTATTGTGGGAAACCACAATATC Gene: VIBHAR_02674: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -215 score = 7.28224 sequence = ATTATTGTGGGAAACCACAATACC Gene: VP1200: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit
sirC	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114 Gene: VF_A0100: Predicted sulfide reductase, anchor subunit	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1199: Predicted sulfide reductase, anchor subunit	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Predicted sulfide reductase, anchor subunit
sirB	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114 Gene: VF_A0099: Predicted sulfide reductase, FeS cluster subunit	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02676: Predicted sulfide reductase, FeS cluster subunit	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1198: Predicted sulfide reductase, FeS cluster subunit	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Predicted sulfide reductase, FeS cluster subunit
yceA	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114 Gene: VF_A0098: Predicted thiosulfate sulfurtransferase	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02677: Predicted thiosulfate sulfurtransferase	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1197: Predicted thiosulfate sulfurtransferase	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Predicted thiosulfate sulfurtransferase

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD