Regulog PhsR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LuxR |
| Regulation mode: | activator |
| Biological process: | Thiosulfate reduction |
| Effector: | Thiosulfate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By trascription factor - PhsR
- By TF family - LuxR
- By effector - Thiosulfate
- By pathway - Thiosulfate reduction
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | ||
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio fischeri ES114 | 6 | 2 |
| Vibrio harveyi ATCC BAA-1116 | 2 | 2 |
| Vibrio parahaemolyticus RIMD 2210633 | 6 | 2 |
| Vibrio salmonicida LFI1238 | ||
| Vibrio shilonii AK1 | ||
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| phsS |
|
|
|
*
Vibrio fischeri ES114 Site: position = -212 score = 7.49854 sequence = ACTATTGTGGTAAACCACAATAAT Gene: VF_A0102: Thiosulfate reduction sensor protein PhsS |
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -225 score = 7.28224 sequence = GGTATTGTGGTTTCCCACAATAAT Gene: VP1201: Thiosulfate reduction sensor protein PhsS |
|
|
|
|
Thiosulfate reduction sensor protein PhsS |
| phsR |
|
|
|
Gene: VF_A0103: Thiosulfate reduction response regulator protein PhsR, LuxR family |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -1904 score = 7.20502 sequence = GATATTGTGGTTTCCCACAATAAT Gene: VIBHAR_02672: Thiosulfate reduction response regulator protein PhsR, LuxR family |
Gene: VP1202: Thiosulfate reduction response regulator protein PhsR, LuxR family |
|
|
|
|
Thiosulfate reduction response regulator protein PhsR, LuxR family |
| CRON 2. | |||||||||||
| sirA |
|
|
|
*
Vibrio fischeri ES114 Site: position = -224 score = 7.49854 sequence = ATTATTGTGGTTTACCACAATAGT Gene: VF_A0101: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -215 score = 7.28224 sequence = ATTATTGTGGGAAACCACAATATC Gene: VIBHAR_02674: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -215 score = 7.28224 sequence = ATTATTGTGGGAAACCACAATACC Gene: VP1200: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit |
|
|
|
|
Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit |
| sirC |
|
|
|
Gene: VF_A0100: Predicted sulfide reductase, anchor subunit |
|
Gene: VP1199: Predicted sulfide reductase, anchor subunit |
|
|
|
|
Predicted sulfide reductase, anchor subunit |
| sirB |
|
|
|
Gene: VF_A0099: Predicted sulfide reductase, FeS cluster subunit |
Gene: VIBHAR_02676: Predicted sulfide reductase, FeS cluster subunit |
Gene: VP1198: Predicted sulfide reductase, FeS cluster subunit |
|
|
|
|
Predicted sulfide reductase, FeS cluster subunit |
| yceA |
|
|
|
Gene: VF_A0098: Predicted thiosulfate sulfurtransferase |
Gene: VIBHAR_02677: Predicted thiosulfate sulfurtransferase |
Gene: VP1197: Predicted thiosulfate sulfurtransferase |
|
|
|
|
Predicted thiosulfate sulfurtransferase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |