Regulon of NagR in Lactobacillus reuteri JCM 1112

Properties
Regulator type:	Transcription factor
TF locus tag:	LAR_0271
Regulator family:	GntR/Others
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Regulog:	NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 79 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By effector - N-acetylglucosamine-6-phosphate
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 4.2 Sequence: AAATTGGTCTAGATTTTTGG Locus tag: LAR_0271 Name: nagR Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
	LAR_0271	nagR	Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
Position: -134 Score: 4.4 Sequence: TAAATCATATAGACCAATCT Position: -43 Score: 4.4 Sequence: CTAGTTATCTATACCAATTT Locus tag: LAR_0405 Name: glmS Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
	LAR_0405	glmS	Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD