Regulon of NagR in Lactobacillus johnsonii NCC 533

Properties
Regulator type:	Transcription factor
TF locus tag:	LJ1739
Regulator family:	GntR/Others
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Regulog:	NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 79 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By effector - N-acetylglucosamine-6-phosphate
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 5.4 Sequence: TAATTTGACTAGACCAATTT Position: -37 Score: 5.4 Sequence: ATAATGGACTAGACCAATGA Locus tag: LJ1823 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	LJ1823	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Position: -109 Score: 5.4 Sequence: TCATTGGTCTAGTCCATTAT Position: -81 Score: 5.4 Sequence: AAATTGGTCTAGTCAAATTA Locus tag: LJ1822 Name: PF00248 Funciton: Oxidoreductase, aldo/keto reductase family
	LJ1822	PF00248	Oxidoreductase, aldo/keto reductase family
Position: -64 Score: 5.8 Sequence: AAATAGGTATATACCAATTA Locus tag: LJ0531 Name: null Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: LJ0532 Name: null Funciton: hypothetical protein
	LJ0531		PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
	LJ0532		hypothetical protein
Position: -130 Score: 5.1 Sequence: CTTTTGATATAGACCAATTA Position: -29 Score: 4.4 Sequence: TAAATGAACTATACCAAAGG Locus tag: LJ1581 Name: glmS Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
	LJ1581	glmS	Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD