Regulon of NagR in Lactobacillus helveticus DPC 4571

Properties
Regulator type:	Transcription factor
TF locus tag:	lhv_0534
Regulator family:	GntR/Others
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Regulog:	NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 79 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By effector - N-acetylglucosamine-6-phosphate
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 5.3 Sequence: TTACTGGTCTAGTCCATTAT Position: -83 Score: 5.6 Sequence: AAAATGGAATAGACCATTTT Locus tag: lhv_2076 Name: PF00248 Funciton: Oxidoreductase, aldo/keto reductase family
	lhv_2076	PF00248	Oxidoreductase, aldo/keto reductase family
Position: -35 Score: 4.5 Sequence: AATGCAATCTAGACCAATTT Locus tag: lhv_0534 Name: nagR Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
	lhv_0534	nagR	Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
Position: -54 Score: 5.6 Sequence: AAAATGGTCTATTCCATTTT Position: -34 Score: 5.3 Sequence: ATAATGGACTAGACCAGTAA Locus tag: lhv_2077 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	lhv_2077	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Position: -131 Score: 4.9 Sequence: AAAATTGATTATACCAATTT Locus tag: lhv_0491 Name: glmS Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
	lhv_0491	glmS	Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD