Regulon of NagR in Lactobacillus casei ATCC 334

Properties
Regulator type:	Transcription factor
TF locus tag:	LSEI_1807
Regulator family:	GntR/Others
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Regulog:	NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 79 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By effector - N-acetylglucosamine-6-phosphate
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -159 Score: 5.3 Sequence: AAATTAATATAGACCAATAT Position: -48 Score: 5.2 Sequence: AAATCTGTCTAAACCAATTT Locus tag: LSEI_1019 Name: glmS Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
	LSEI_1019	glmS	Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Position: -77 Score: 5 Sequence: ATTACGGTATAGACCACTAT Position: -34 Score: 5.1 Sequence: ACATTGGACTAGACCAGATA Locus tag: LSEI_2889 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	LSEI_2889	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Position: -73 Score: 5.3 Sequence: ATCTTGGTCTATACCAGTTA Locus tag: LSEI_1808 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) Locus tag: LSEI_1807 Name: nagR Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
	LSEI_1808	nagA	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
	LSEI_1807	nagR	Transcriptional regulator of N-Acetylglucosamine utilization, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD