Regulon of AmtR in Streptomyces avermitilis MA-4680

Properties
Regulator type:	Transcription factor
TF locus tag:	SAV_6701
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Streptomycetaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By trascription factor - AmtR
By taxonomy - Streptomycetaceae
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 7.7 Sequence: AATTTCTGTCGGGCGACAGAAATC Locus tag: SAV_6700 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: SAV_6699 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: SAV_6698 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6) Locus tag: SAV_6697 Name: ucaB Funciton: Allophanate hydrolase (EC 3.5.1.54)
	SAV_6700	amt1	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	SAV_6699	amt2	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	SAV_6698	ucaA	Urea carboxylase (EC 6.3.4.6)
	SAV_6697	ucaB	Allophanate hydrolase (EC 3.5.1.54)
Position: -35 Score: 7.7 Sequence: AATTTCTGTCGCCCGACAGGAACT Locus tag: SAV_6709 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family
	SAV_6709	uctT	Urea carboxylase-related transporter, Amino acid permease family
Position: -155 Score: 7.9 Sequence: GATTTCTGTCGCCCGACAGAAATT Locus tag: SAV_6701 Name: amtR Funciton: Transcriptional regulator of urea utilization, TetR family
	SAV_6701	amtR	Transcriptional regulator of urea utilization, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD