Regulog AmtR - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Nitrogen metabolism |
| Effector: | GlnK-AMP, signal transduction protein |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - AmtR
- By taxonomy - Streptomycetaceae
- By TF family - TetR
- By effector - GlnK-AMP, signal transduction protein
- By pathway - Nitrogen metabolism
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 6 | 3 |
| Streptomyces coelicolor A3(2) | ||
| Streptomyces griseus subsp. griseus NBRC 13350 | ||
| Streptomyces scabiei 87.22 | 6 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| amtR |
*
Streptomyces avermitilis MA-4680 Site: position = -155 score = 7.88712 sequence = GATTTCTGTCGCCCGACAGAAATT Gene: SAV_6701: Transcriptional regulator of urea utilization, TetR family |
|
|
*
Streptomyces scabiei 87.22 Site: position = -156 score = 7.88712 sequence = GATTTCTGTCGCGCGACAGAAATT Gene: SCAB_73671: Transcriptional regulator of urea utilization, TetR family |
Transcriptional regulator of urea utilization, TetR family |
| CRON 2. | |||||
| uctT |
*
Streptomyces avermitilis MA-4680 Site: position = -35 score = 7.65539 sequence = AATTTCTGTCGCCCGACAGGAACT Gene: SAV_6709: Urea carboxylase-related transporter, Amino acid permease family |
|
|
*
Streptomyces scabiei 87.22 Site: position = -78 score = 7.88712 sequence = AATTTCTGTCGCCCGACAGGAATT Gene: SCAB_73751: Urea carboxylase-related transporter, Amino acid permease family |
Urea carboxylase-related transporter, Amino acid permease family |
| CRON 3. | |||||
| amt1 |
*
Streptomyces avermitilis MA-4680 Site: position = -54 score = 7.65539 sequence = AATTTCTGTCGGGCGACAGAAATC Gene: SAV_6700: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
*
Streptomyces scabiei 87.22 Site: position = -126 score = 7.88712 sequence = AATTTCTGTCGCGCGACAGAAATC Gene: SCAB_73661: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| amt2 |
Gene: SAV_6699: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
Gene: SCAB_73651: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| ucaA |
Gene: SAV_6698: Urea carboxylase (EC 6.3.4.6) |
|
|
Gene: SCAB_73641: Urea carboxylase (EC 6.3.4.6) |
Urea carboxylase (EC 6.3.4.6) |
| ucaB |
Gene: SAV_6697: Allophanate hydrolase (EC 3.5.1.54) |
|
|
Gene: SCAB_73631: Allophanate hydrolase (EC 3.5.1.54) |
Allophanate hydrolase (EC 3.5.1.54) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |