Regulon of Zur in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:	SCAB_61951
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Streptomycetaceae
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5 Sequence: TGTTGACAATCGTTTCCAGAT Position: -17 Score: 5.1 Sequence: AGATGAAAATGACTGTCATGA Locus tag: SCAB_61981 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: SCAB_61971 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: SCAB_61961 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: SCAB_61951 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	SCAB_61981	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	SCAB_61971	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	SCAB_61961	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	SCAB_61951	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -64 Score: 5.1 Sequence: TAATGGGATCCATTTTCATGT Locus tag: SCAB_41531 Name: rpmF2 Funciton: LSU ribosomal protein L32p
	SCAB_41531	rpmF2	LSU ribosomal protein L32p
Position: -31 Score: 5.9 Sequence: AAATGGAATTCATTTTCAGTA Locus tag: SCAB_40001 Name: rpmG2 Funciton: LSU ribosomal protein L33p Locus tag: SCAB_39991 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: SCAB_39981 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: SCAB_39971 Name: rpsR2 Funciton: SSU ribosomal protein S18p
	SCAB_40001	rpmG2	LSU ribosomal protein L33p
	SCAB_39991	rpmE2	LSU ribosomal protein L31p
	SCAB_39981	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	SCAB_39971	rpsR2	SSU ribosomal protein S18p
Position: -66 Score: 5.9 Sequence: TACTGAAAATGAATTCCATTT Locus tag: SCAB_40011 Name: rpmB2 Funciton: LSU ribosomal protein L28p Locus tag: SCAB_40021 Name: rpsN2 Funciton: SSU ribosomal protein S14p Locus tag: SCAB_40031 Name: SC03431 Funciton: possible membrane protein
	SCAB_40011	rpmB2	LSU ribosomal protein L28p
	SCAB_40021	rpsN2	SSU ribosomal protein S14p
	SCAB_40031	SC03431	possible membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD