Regulon of TyrR in Vibrio fischeri ES114

Properties
Regulator type:	Transcription factor
TF locus tag:	VF_A0751
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Vibrionales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 83 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Vibrionales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 5.1 Sequence: CTGTAAACTTAAATTTACGA Position: -29 Score: 5.8 Sequence: ATGGAAATAAAAGTTTACAG Locus tag: VF_0553 Name: aroF Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) Locus tag: VF_0554 Name: tyrA Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
	VF_0553	aroF	2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
	VF_0554	tyrA	Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Position: -78 Score: 5.2 Sequence: ATGTACAAAAATATGTACAC Locus tag: VF_1605 Name: COG0733 Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
	VF_1605	COG0733	Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
Position: -41 Score: 5.6 Sequence: GTGTAAACATATTTTGACAC Locus tag: VF_A0751 Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
	VF_A0751	tyrR	Transcriptional regulator of aromatic amino acid biosynthesis
Position: -132 Score: 6.1 Sequence: GTGTAAACATATAATTACAG Locus tag: VF_1197 Name: tyrP Funciton: tyrosine-specific transport protein
	VF_1197	tyrP	tyrosine-specific transport protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD