Regulon of HrcA in Thermus aquaticus Y51MC23

Properties
Regulator type:	Transcription factor
TF locus tag:	TaqDRAFT_3910
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Deinococcus-Thermus
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Deinococcus-Thermus
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 7 Sequence: TTGACACTCTCGCCCTTGGAGCGTCAA Locus tag: TaqDRAFT_4600 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: TaqDRAFT_4601 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	TaqDRAFT_4600	groS	Heat shock protein 60 family co-chaperone GroES
	TaqDRAFT_4601	groL	Heat shock protein 60 family chaperone GroEL
Position: -50 Score: 7.2 Sequence: TTGACACTCAATGGCTTTGAGTGTCAG Locus tag: TaqDRAFT_5069 Name: COG2331 Funciton: Conserved hypothetical protein
	TaqDRAFT_5069	COG2331	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD