Regulog HrcA - Deinococcus-Thermus
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Deinococcus-Thermus |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - HrcA
- By taxonomy - Deinococcus-Thermus
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Deinococcus deserti VCD115 | ||
| Deinococcus geothermalis DSM 11300 | ||
| Deinococcus radiodurans R1 | ||
| Thermus aquaticus Y51MC23 | 3 | 2 |
| Thermus thermophilus HB27 | 3 | 2 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| groS |
Gene: Deide_22580: Heat shock protein 60 family co-chaperone GroES |
Gene: Dgeo_2230: Heat shock protein 60 family co-chaperone GroES |
Gene: DR_0606: Heat shock protein 60 family co-chaperone GroES |
*
Thermus aquaticus Y51MC23 Site: position = -41 score = 6.98441 sequence = TTGACACTCTCGCCCTTGGAGCGTCAA Gene: TaqDRAFT_4600: Heat shock protein 60 family co-chaperone GroES |
*
Thermus thermophilus HB27 Site: position = -41 score = 7.03413 sequence = TTGACACTCTCACCCTTTGGGCGTCAA Gene: TTC1713: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: Deide_22590: Heat shock protein 60 family chaperone GroEL |
Gene: Dgeo_2231: Heat shock protein 60 family chaperone GroEL |
Gene: DR0607: Heat shock protein 60 family chaperone GroEL |
Gene: TaqDRAFT_4601: Heat shock protein 60 family chaperone GroEL |
Gene: TTC1714: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
| CRON 2. | ||||||
| COG2331 |
Gene: Deide_21540: Conserved hypothetical protein |
Gene: Dgeo_0104: Conserved hypothetical protein |
Gene: DR0301: Conserved hypothetical protein |
*
Thermus aquaticus Y51MC23 Site: position = -50 score = 7.24035 sequence = TTGACACTCAATGGCTTTGAGTGTCAG Gene: TaqDRAFT_5069: Conserved hypothetical protein |
*
Thermus thermophilus HB27 Site: position = -50 score = 6.43415 sequence = TTGACACTCAAGAAGGCTAAGCGTCAA Gene: TTC1246: Conserved hypothetical protein |
Conserved hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |