Regulon of NrtR in Rhodococcus opacus B4

Properties
Regulator type:	Transcription factor
TF locus tag:	ROP_15940
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Nocardiaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Nocardiaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.2 Sequence: TTGTAGTCATATCGACTACAA Position: -30 Score: 5.3 Sequence: TTGTAGTCACTACGACTACAA Locus tag: ROP_15920 Name: pnuC Funciton: Ribosyl nicotinamide transporter, PnuC family Locus tag: ROP_15930 Name: nadR Funciton: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) Locus tag: ROP_15940 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	ROP_15920	pnuC	Ribosyl nicotinamide transporter, PnuC family
	ROP_15930	nadR	Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
	ROP_15940	nrtR	Nudix-related transcriptional regulator NrtR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD