Profile of regulator NrtR in Nocardiaceae
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Regulog: | NrtR - Nocardiaceae |
Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Nocardiaceae
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Rhodococcus opacus B4 | |||||
| ROP_15920 | pnuC | -30 | 5.3 | TTGTAGTCACTACGACTACAA | |
| ROP_15920 | pnuC | -64 | 5.2 | TTGTAGTCATATCGACTACAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |