Regulog NrtR - Nocardiaceae

Properties
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Nocardia farcinica IFM 10152
Rhodococcus erythropolis PR4
Rhodococcus opacus B4	3	1
Rhodococcus sp. RHA1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
pnuC	Nocardia farcinica IFM 10152	Rhodococcus erythropolis PR4	* Rhodococcus opacus B4 Site: position = -30 score = 5.25577 sequence = TTGTAGTCACTACGACTACAA Site: position = -64 score = 5.1891 sequence = TTGTAGTCATATCGACTACAA Gene: ROP_15920: Ribosyl nicotinamide transporter, PnuC family	Rhodococcus sp. RHA1	Ribosyl nicotinamide transporter, PnuC family
nadR	Nocardia farcinica IFM 10152	Rhodococcus erythropolis PR4	Rhodococcus opacus B4 Gene: ROP_15930: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)	Rhodococcus sp. RHA1	Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
nrtR	Nocardia farcinica IFM 10152	Rhodococcus erythropolis PR4	Rhodococcus opacus B4 Gene: ROP_15940: Nudix-related transcriptional regulator NrtR	Rhodococcus sp. RHA1	Nudix-related transcriptional regulator NrtR

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --