Regulog NrtR - Nocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Nocardiaceae
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Nocardia farcinica IFM 10152 | ||
| Rhodococcus erythropolis PR4 | ||
| Rhodococcus opacus B4 | 3 | 1 |
| Rhodococcus sp. RHA1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| pnuC |
|
|
*
Rhodococcus opacus B4 Site: position = -30 score = 5.25577 sequence = TTGTAGTCACTACGACTACAA Site: position = -64 score = 5.1891 sequence = TTGTAGTCATATCGACTACAA Gene: ROP_15920: Ribosyl nicotinamide transporter, PnuC family |
|
Ribosyl nicotinamide transporter, PnuC family |
| nadR |
|
|
Gene: ROP_15930: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) |
|
Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) |
| nrtR |
|
|
Gene: ROP_15940: Nudix-related transcriptional regulator NrtR |
|
Nudix-related transcriptional regulator NrtR |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |