Regulon of VIBHAR_07005 in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_07005
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	VIBHAR_07005 - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: 82 Score: 6.8 Sequence: TGGTGTTATACATATATATAACACCA Locus tag: VIBHAR_07005 Name: VIBHAR_07005 Funciton: Transcriptional regulator, GntR family Locus tag: VIBHAR_07006 Name: XAC1547 Funciton: ABC transporter, ATP-binding protein Locus tag: VIBHAR_07007 Name: XAC1546 Funciton: ABC transporter, permease protein
	VIBHAR_07005	VIBHAR_07005	Transcriptional regulator, GntR family
	VIBHAR_07006	XAC1547	ABC transporter, ATP-binding protein
	VIBHAR_07007	XAC1546	ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD