Regulog VIBHAR_07005 - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | 3 | 1 |
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio fischeri ES114 | ||
| Vibrio harveyi ATCC BAA-1116 | 3 | 1 |
| Vibrio parahaemolyticus RIMD 2210633 | 3 | 1 |
| Vibrio salmonicida LFI1238 | ||
| Vibrio shilonii AK1 | 3 | 1 |
| Vibrio splendidus LGP32 | 3 | 1 |
| Vibrio vulnificus CMCP6 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| VIBHAR_07005 |
*
Photobacterium profundum SS9 Site: position = -47 score = 6.52456 sequence = TGGTGTTATATATCACTATAACAGTA Gene: PBPRA2039: Transcriptional regulator, GntR family |
|
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = 82 score = 6.84912 sequence = TGGTGTTATACATATATATAACACCA Gene: VIBHAR_07005: Transcriptional regulator, GntR family |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -39 score = 6.69691 sequence = TAGTGTTATACATATATATAACACCA Gene: VPA0034: Transcriptional regulator, GntR family |
|
*
Vibrio shilonii AK1 Site: position = -45 score = 6.32109 sequence = AGGTGTTATACATATATATAACACCA Gene: VSAK1_22894: Transcriptional regulator, GntR family |
*
Vibrio splendidus LGP32 Site: position = -39 score = 6.22939 sequence = TAGTGTTATACACATGTATATCACCA Gene: VS_II1187: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
| XAC1547 |
Gene: PBPRA2038: ABC transporter, ATP-binding protein |
Gene: VAS14_01881: ABC transporter, ATP-binding protein |
|
Gene: VF_A0912: ABC transporter, ATP-binding protein |
Gene: VIBHAR_07006: ABC transporter, ATP-binding protein |
Gene: VPA0033: ABC transporter, ATP-binding protein |
Gene: VSAL_II0948: ABC transporter, ATP-binding protein |
Gene: VSAK1_22899: ABC transporter, ATP-binding protein |
Gene: VS_II1188: ABC transporter, ATP-binding protein |
|
ABC transporter, ATP-binding protein |
| XAC1546 |
Gene: PBPRA2037: ABC transporter, permease protein |
Gene: VAS14_01886: ABC transporter, permease protein |
|
Gene: VF_A0913: ABC transporter, permease protein |
Gene: VIBHAR_07007: ABC transporter, permease protein |
Gene: VPA0032: ABC transporter, permease protein |
Gene: VSAL_II0949: ABC transporter, permease protein |
Gene: VSAK1_22904: ABC transporter, permease protein |
Gene: VS_II1189: ABC transporter, permease protein |
|
ABC transporter, permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |