Regulon of MerR in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type:	Transcription factor
TF locus tag:	ASA_P4G087
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -9 Score: 6.3 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: ASA_P4G088 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: ASA_P4G089 Name: merP Funciton: Periplasmic mercury(+2) binding protein Locus tag: ASA_P4G090 Name: merC Funciton: Mercury uptake inner membane protein Locus tag: ASA_P4G091 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: ASA_P4G092 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: ASA_P4G093 Name: merE Funciton: Putative mercury resistance protein Locus tag: ASA_P4G094 Name: PF00563 Funciton: Diguanylate phosphodiesterase, EAL domain
	ASA_P4G088	merT	Mercury uptake inner membane protein
	ASA_P4G089	merP	Periplasmic mercury(+2) binding protein
	ASA_P4G090	merC	Mercury uptake inner membane protein
	ASA_P4G091	merA	Mercuric ion reductase (EC 1.16.1.1)
	ASA_P4G092	merD	Mercuric resistance operon coregulator
	ASA_P4G093	merE	Putative mercury resistance protein
	ASA_P4G094	PF00563	Diguanylate phosphodiesterase, EAL domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD