Profile of regulator MerR in Psychromonadaceae/Aeromonadales
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Regulog: | MerR - Psychromonadaceae/Aeromonadales |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Psychromonas ingrahamii 37 | |||||
| Ping_1945 | merP | -358 | 5.7 | ACTCCCTACTTGGGTACGGCAT | |
| Aeromonas salmonicida subsp. salmonicida A449 | |||||
| ASA_P4G088 | merT | -9 | 6.3 | ACTCCGTACATGAGTACGGAAG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |