Regulog MerR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | 1 | 1 |
| Psychromonas sp. CNPT3 | ||
| Moritella sp. PE36 | ||
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||
| Aeromonas salmonicida subsp. salmonicida A449 | 7 | 1 |
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| merT |
|
|
|
|
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -9 score = 6.32826 sequence = ACTCCGTACATGAGTACGGAAG Gene: ASA_P4G088: Mercury uptake inner membane protein |
|
Mercury uptake inner membane protein |
| merP |
|
|
|
|
Gene: ASA_P4G089: Periplasmic mercury(+2) binding protein |
|
Periplasmic mercury(+2) binding protein |
| merC |
|
|
|
|
Gene: ASA_P4G090: Mercury uptake inner membane protein |
|
Mercury uptake inner membane protein |
| merA |
|
|
|
|
Gene: ASA_P4G091: Mercuric ion reductase (EC 1.16.1.1) |
|
Mercuric ion reductase (EC 1.16.1.1) |
| merD |
|
|
|
|
Gene: ASA_P4G092: Mercuric resistance operon coregulator |
|
Mercuric resistance operon coregulator |
| merE |
|
|
|
|
Gene: ASA_P4G093: Putative mercury resistance protein |
|
Putative mercury resistance protein |
| PF00563 |
|
|
|
|
Gene: ASA_P4G094: Diguanylate phosphodiesterase, EAL domain |
|
Diguanylate phosphodiesterase, EAL domain |
| CRON 2. | |||||||
| merP |
*
Psychromonas ingrahamii 37 Site: position = -358 score = 5.66749 sequence = ACTCCCTACTTGGGTACGGCAT Gene: Ping_1945: Periplasmic mercury(+2) binding protein |
|
|
|
|
|
Periplasmic mercury(+2) binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |