Regulog MerR - Psychromonadaceae/Aeromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Statistics of regulated genes
Genome	Genes	Operons
Psychromonas ingrahamii 37	1	1
Psychromonas sp. CNPT3
Moritella sp. PE36
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449	7	1
Tolumonas auensis DSM 9187

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
merT	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	* Aeromonas salmonicida subsp. salmonicida A449 Site: position = -9 score = 6.32826 sequence = ACTCCGTACATGAGTACGGAAG Gene: ASA_P4G088: Mercury uptake inner membane protein	Tolumonas auensis DSM 9187	Mercury uptake inner membane protein
merP	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_P4G089: Periplasmic mercury(+2) binding protein	Tolumonas auensis DSM 9187	Periplasmic mercury(+2) binding protein
merC	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_P4G090: Mercury uptake inner membane protein	Tolumonas auensis DSM 9187	Mercury uptake inner membane protein
merA	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_P4G091: Mercuric ion reductase (EC 1.16.1.1)	Tolumonas auensis DSM 9187	Mercuric ion reductase (EC 1.16.1.1)
merD	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_P4G092: Mercuric resistance operon coregulator	Tolumonas auensis DSM 9187	Mercuric resistance operon coregulator
merE	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_P4G093: Putative mercury resistance protein	Tolumonas auensis DSM 9187	Putative mercury resistance protein
PF00563	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_P4G094: Diguanylate phosphodiesterase, EAL domain	Tolumonas auensis DSM 9187	Diguanylate phosphodiesterase, EAL domain

CRON 2.
merP	* Psychromonas ingrahamii 37 Site: position = -358 score = 5.66749 sequence = ACTCCCTACTTGGGTACGGCAT Gene: Ping_1945: Periplasmic mercury(+2) binding protein	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Periplasmic mercury(+2) binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MerR - Psychromonadaceae/Aeromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --