Regulon of ZntR in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_2331
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Regulog:	ZntR - Caulobacterales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - ZntR
By TF family - MerR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 4.5 Sequence: ACCTTGGACCACGGTCCAACCT Locus tag: Caul_2331 Name: zntR Funciton: Zinc resistance ranscriptional regulator, MerR family
	Caul_2331	zntR	Zinc resistance ranscriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD