Profile of regulator ZntR in Caulobacterales
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Zinc resistance |
Effector: | Zinc ion, (Zn2+) |
Regulog: | ZntR - Caulobacterales |

Member of regulog collections
- By taxonomy - Caulobacterales
- By trascription factor - ZntR
- By TF family - MerR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc resistance
Transcription factor binding sites
Locus Tag | Name | Position | Score | Sequence | |
---|---|---|---|---|---|
Caulobacter sp. K31 | |||||
Caul_2331 | zntR | -40 | 4.5 | ACCTTGGACCACGGTCCAACCT |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |