Regulog ZntR - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15
Caulobacter segnis ATCC 21756
Caulobacter sp. K31	1	1
Phenylobacterium zucineum HLK1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
zntR	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -40 score = 4.46026 sequence = ACCTTGGACCACGGTCCAACCT Gene: Caul_2331: Zinc resistance ranscriptional regulator, MerR family	Phenylobacterium zucineum HLK1	Zinc resistance ranscriptional regulator, MerR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --