Regulon of GntR in Azospirillum sp. B510

Properties
Regulator type:	Transcription factor
TF locus tag:	AZL_d00370
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -138 Score: 5.6 Sequence: CAAGGTTAGCGCTAACAGTA Position: -48 Score: 6.1 Sequence: TCATGATAGCGCTAACATAA Locus tag: AZL_d00380 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: AZL_d00390 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: AZL_d00400 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: AZL_d00410 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
	AZL_d00380	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	AZL_d00390	gntZ	Predicted gluconate TRAP family transporter, DctM subunit
	AZL_d00400	gntY	Predicted gluconate TRAP family transporter, DctQ subunit
	AZL_d00410	gntX	Predicted gluconate TRAP family transporter, DctP subunit
Position: -114 Score: 6.2 Sequence: CGATGTAAGCGCTTACATAG Position: -47 Score: 5.5 Sequence: ATATGTAACCGCTTTCAAAA Locus tag: AZL_a08610 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	AZL_a08610	gntR	Gluconate utilization transcriptional regulator GntR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD