Regulog GntR - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | ||
| Magnetospirillum magnetotacticum MS-1 | ||
| Magnetospirillum magneticum AMB-1 | ||
| Azospirillum sp. B510 | 5 | 2 |
| Rhodospirillum centenum SW | ||
| Gluconacetobacter diazotrophicus PAl 5 | ||
| Acetobacter pasteurianus IFO 3283-01 | ||
| Gluconobacter oxydans 621H | ||
| Granulibacter bethesdensis CGDNIH1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| gntR |
|
|
|
*
Azospirillum sp. B510 Site: position = -114 score = 6.17799 sequence = CGATGTAAGCGCTTACATAG Site: position = -47 score = 5.45415 sequence = ATATGTAACCGCTTTCAAAA Gene: AZL_a08610: Gluconate utilization transcriptional regulator GntR, LacI family |
|
|
|
|
|
Gluconate utilization transcriptional regulator GntR, LacI family |
| CRON 2. | ||||||||||
| gntK |
|
|
|
*
Azospirillum sp. B510 Site: position = -138 score = 5.58386 sequence = CAAGGTTAGCGCTAACAGTA Site: position = -48 score = 6.08558 sequence = TCATGATAGCGCTAACATAA Gene: AZL_d00380: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
|
|
|
|
Thermoresistant gluconokinase (EC 2.7.1.12) |
| gntZ |
|
|
|
Gene: AZL_d00390: Predicted gluconate TRAP family transporter, DctM subunit |
|
|
|
|
|
Predicted gluconate TRAP family transporter, DctM subunit |
| gntY |
|
|
|
Gene: AZL_d00400: Predicted gluconate TRAP family transporter, DctQ subunit |
|
|
|
|
|
Predicted gluconate TRAP family transporter, DctQ subunit |
| gntX |
|
|
|
Gene: AZL_d00410: Predicted gluconate TRAP family transporter, DctP subunit |
|
|
|
|
|
Predicted gluconate TRAP family transporter, DctP subunit |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |