Regulon of GntR in Chromobacterium violaceum ATCC 12472

Properties
Regulator type:	Transcription factor
TF locus tag:	CV2956
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -20 Score: 6.7 Sequence: TTTTGTTAGCGCTAACATCA Locus tag: CV2957 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: CV2958 Name: gntP Funciton: Predicted gluconate permease
	CV2957	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	CV2958	gntP	Predicted gluconate permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD