Regulog GntR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | ||
| Thauera sp. MZ1T | ||
| Dechloromonas aromatica RCB | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | ||
| Chromobacterium violaceum ATCC 12472 | 2 | 1 |
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | ||
| Methylobacillus flagellatus KT | ||
| Methylotenera mobilis JLW8 | ||
| Methylophilales bacterium HTCC2181 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| gntK |
|
|
|
|
|
|
*
Chromobacterium violaceum ATCC 12472 Site: position = -20 score = 6.66292 sequence = TTTTGTTAGCGCTAACATCA Gene: CV2957: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
|
|
|
|
Thermoresistant gluconokinase (EC 2.7.1.12) |
| gntP |
|
|
|
|
|
|
Gene: CV2958: Predicted gluconate permease |
|
|
|
|
|
Predicted gluconate permease |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |