Profile of regulator GntR in Various betaproteobacteria
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Regulog: | GntR - Various betaproteobacteria |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Chromobacterium violaceum ATCC 12472 | |||||
| CV2957 | gntK | -20 | 6.7 | TTTTGTTAGCGCTAACATCA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |