Regulon of GntR in Burkholderia phymatum STM815

Properties
Regulator type:	Transcription factor
TF locus tag:	Bphy_5547
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Burkholderia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 6.7 Sequence: CCGAGACAGCGCTGTCTCAG Position: -27 Score: 6.2 Sequence: TTGAGACAGCGCTATCCTAA Locus tag: Bphy_5547 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Bphy_5547	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -137 Score: 6.2 Sequence: TTAGGATAGCGCTGTCTCAA Position: -35 Score: 6.7 Sequence: CTGAGACAGCGCTGTCTCGG Locus tag: Bphy_5548 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Bphy_5549 Name: gntP Funciton: Predicted gluconate permease Locus tag: Bphy_5550 Name: gntO Funciton: Predicted gluconate specific outer membrane porin
	Bphy_5548	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	Bphy_5549	gntP	Predicted gluconate permease
	Bphy_5550	gntO	Predicted gluconate specific outer membrane porin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD