Profile of regulator GntR in Burkholderia

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Burkholderia

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Burkholderia phymatum STM815
	Bphy_5548	gntK	-35	6.7	CTGAGACAGCGCTGTCTCGG
	Bphy_5548	gntK	-137	6.2	TTAGGATAGCGCTGTCTCAA
	Bphy_5547	gntR	-27	6.2	TTGAGACAGCGCTATCCTAA
	Bphy_5547	gntR	-129	6.7	CCGAGACAGCGCTGTCTCAG

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD