Regulog GntR - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia pseudomallei K96243 | ||
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia sp. 383 | ||
| Burkholderia cepacia AMMD | ||
| Burkholderia vietnamiensis G4 | ||
| Burkholderia glumae BGR1 | ||
| Burkholderia xenovorans LB400 | ||
| Burkholderia phymatum STM815 | 4 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| gntR |
|
|
|
|
|
|
|
*
Burkholderia phymatum STM815 Site: position = -27 score = 6.21942 sequence = TTGAGACAGCGCTATCCTAA Site: position = -129 score = 6.73082 sequence = CCGAGACAGCGCTGTCTCAG Gene: Bphy_5547: Gluconate utilization transcriptional regulator GntR, LacI family |
Gluconate utilization transcriptional regulator GntR, LacI family |
| CRON 2. | |||||||||
| gntK |
|
|
|
|
|
|
|
*
Burkholderia phymatum STM815 Site: position = -35 score = 6.73082 sequence = CTGAGACAGCGCTGTCTCGG Site: position = -137 score = 6.21942 sequence = TTAGGATAGCGCTGTCTCAA Gene: Bphy_5548: Thermoresistant gluconokinase (EC 2.7.1.12) |
Thermoresistant gluconokinase (EC 2.7.1.12) |
| gntP |
|
|
|
|
|
|
|
Gene: Bphy_5549: Predicted gluconate permease |
Predicted gluconate permease |
| gntO |
|
|
|
|
|
|
|
Gene: Bphy_5550: Predicted gluconate specific outer membrane porin |
Predicted gluconate specific outer membrane porin |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |