Regulon of GntR in Actinobacillus pleuropneumoniae serovar 7 str. AP76

Properties
Regulator type:	Transcription factor
TF locus tag:	APP7_1727
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Pasteurellales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -131 Score: 6 Sequence: TAATGTTACAGGTAACATTA Position: -42 Score: 6.2 Sequence: TTATGTTACCAGTAACAATT Locus tag: APP7_1725 Name: gntU Funciton: Low-affinity gluconate transporter
	APP7_1725	gntU	Low-affinity gluconate transporter
Position: -155 Score: 6.2 Sequence: AATTGTTACTGGTAACATAA Position: -66 Score: 6 Sequence: TAATGTTACCTGTAACATTA Locus tag: APP7_1726 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	APP7_1726	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD