Regulon of GntR in Mannheimia succiniciproducens MBEL55E

Properties
Regulator type:	Transcription factor
TF locus tag:	MS1242
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Pasteurellales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -167 Score: 5.5 Sequence: AACAGTTACCGATAACAATA Position: -36 Score: 5.6 Sequence: GTATGTTACCAGTAACCAAT Locus tag: MS0956 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264) Locus tag: MS0955 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: MS0954 Name: gntU Funciton: Low-affinity gluconate transporter Locus tag: MS0953 Name: gntU Funciton: Low-affinity gluconate transporter
	MS0956	idnD	L-idonate 5-dehydrogenase (EC 1.1.1.264)
	MS0955	idnO	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	MS0954	gntU	Low-affinity gluconate transporter
	MS0953	gntU	Low-affinity gluconate transporter
Position: -201 Score: 5.6 Sequence: ATTGGTTACTGGTAACATAC Position: -70 Score: 5.5 Sequence: TATTGTTATCGGTAACTGTT Locus tag: MS0957 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	MS0957	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD