Regulon of GntR in Vibrio angustum S14

Properties
Regulator type:	Transcription factor
TF locus tag:	VAS14_06913
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 6.3 Sequence: CCATGTTACGGGTAACATGT Position: -93 Score: 6.2 Sequence: ACATGTTACCCGTAACATTG Locus tag: VAS14_06893 Name: gntU Funciton: Low-affinity gluconate transporter
	VAS14_06893	gntU	Low-affinity gluconate transporter
Position: -89 Score: 6.2 Sequence: CAATGTTACGGGTAACATGT Position: -75 Score: 6.3 Sequence: ACATGTTACCCGTAACATGG Locus tag: VAS14_06898 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: VAS14_06903 Name: edd Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12)
	VAS14_06898	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	VAS14_06903	edd	6-phosphogluconate dehydratase (EC 4.2.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD