Regulon of GntR in Vibrio vulnificus CMCP6

Properties
Regulator type:	Transcription factor
TF locus tag:	VV1_1098
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Vibrionales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.7 Sequence: TAATGTTACAAGTAACATTA Locus tag: VV1_1098 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	VV1_1098	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -107 Score: 6.1 Sequence: TTACGTTACCGGTAACATGT Position: -93 Score: 6.5 Sequence: ACATGTTACCGATAACATGA Locus tag: VV1_1100 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: VV1_1099 Name: edd Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12)
	VV1_1100	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	VV1_1099	edd	6-phosphogluconate dehydratase (EC 4.2.1.12)
Position: -79 Score: 6.5 Sequence: TCATGTTATCGGTAACATGT Position: -65 Score: 6.1 Sequence: ACATGTTACCGGTAACGTAA Locus tag: VV1_1101 Name: gntU Funciton: Low-affinity gluconate transporter Locus tag: VV1_1102 Name: eda Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
	VV1_1101	gntU	Low-affinity gluconate transporter
	VV1_1102	eda	2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD