Regulon of CzcR1 in Lactobacillus reuteri JCM 1112

Properties
Regulator type:	Transcription factor
TF locus tag:	LAR_1706
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog:	CzcR1 - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - CzrA
By TF family - ArsR
By pathway - Zinc resistance
By pathway - Cobalt resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.5 Sequence: ATATATCAAATTCGATATAT Position: -33 Score: 6.3 Sequence: GTATATCGAATTTGATATAT Locus tag: LAR_1705 Name: cadD1 Funciton: Predicted permease, cadmium resistance protein Locus tag: LAR_1706 Name: czcR1 Funciton: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
	LAR_1705	cadD1	Predicted permease, cadmium resistance protein
	LAR_1706	czcR1	Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD