Regulon of NigR in Streptococcus mutans UA159

Properties
Regulator type:	Transcription factor
TF locus tag:	SMU.105
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Nigerose utilization
Effector:	Nigerose-6-phosphate
Regulog:	NigR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Nigerose-6-phosphate
By pathway - Nigerose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 5.8 Sequence: AATATGGAACGTTCCATGTA Position: -37 Score: 4.7 Sequence: GAAATTGAACGTTCAATATT Locus tag: SMU.100 Name: nigB Funciton: Nigerose-specific PTS system, EIIB component Locus tag: SMU.101 Name: nigC Funciton: Nigerose-specific PTS system, EIIC component Locus tag: SMU.102 Name: nigD Funciton: Nigerose-specific PTS system, EIID component Locus tag: SMU.103 Name: nigA Funciton: Nigerose-specific PTS system, EIIA component Locus tag: SMU.104 Name: nigE Funciton: Cytoplasmic alpha-glucosidase, family 31 of glycosyl hydrolase Locus tag: SMU.105 Name: nigR Funciton: Nigerose utilization repressor, LacI family
	SMU.100	nigB	Nigerose-specific PTS system, EIIB component
	SMU.101	nigC	Nigerose-specific PTS system, EIIC component
	SMU.102	nigD	Nigerose-specific PTS system, EIID component
	SMU.103	nigA	Nigerose-specific PTS system, EIIA component
	SMU.104	nigE	Cytoplasmic alpha-glucosidase, family 31 of glycosyl hydrolase
	SMU.105	nigR	Nigerose utilization repressor, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD