Profile of regulator NigR in Streptococcaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Nigerose utilization |
| Effector: | Nigerose-6-phosphate |
| Regulog: | NigR - Streptococcaceae |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LacI
- By effector - Nigerose-6-phosphate
- By pathway - Nigerose utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Streptococcus mutans UA159 | |||||
| SMU.100 | nigB | -102 | 5.8 | AATATGGAACGTTCCATGTA | |
| SMU.100 | nigB | -37 | 4.7 | GAAATTGAACGTTCAATATT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |