Regulog NigR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Nigerose utilization |
| Effector: | Nigerose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LacI
- By effector - Nigerose-6-phosphate
- By pathway - Nigerose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | ||
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | 6 | 1 |
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | ||
| Streptococcus suis 05ZYH33 | ||
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| nigB |
|
|
|
|
|
|
|
|
*
Streptococcus mutans UA159 Site: position = -102 score = 5.77868 sequence = AATATGGAACGTTCCATGTA Site: position = -37 score = 4.73076 sequence = GAAATTGAACGTTCAATATT Gene: SMU.100: Nigerose-specific PTS system, EIIB component |
|
|
|
|
|
|
Nigerose-specific PTS system, EIIB component |
| nigC |
|
|
|
|
|
|
|
|
Gene: SMU.101: Nigerose-specific PTS system, EIIC component |
|
|
|
|
|
|
Nigerose-specific PTS system, EIIC component |
| nigD |
|
|
|
|
|
|
|
|
Gene: SMU.102: Nigerose-specific PTS system, EIID component |
|
|
|
|
|
|
Nigerose-specific PTS system, EIID component |
| nigA |
|
|
|
|
|
|
|
|
Gene: SMU.103: Nigerose-specific PTS system, EIIA component |
|
|
|
|
|
|
Nigerose-specific PTS system, EIIA component |
| nigE |
|
|
|
|
|
|
|
|
Gene: SMU.104: Cytoplasmic alpha-glucosidase, family 31 of glycosyl hydrolase |
|
|
|
|
|
|
Cytoplasmic alpha-glucosidase, family 31 of glycosyl hydrolase |
| nigR |
|
|
|
|
|
|
|
|
Gene: SMU.105: Nigerose utilization repressor, LacI family |
|
|
|
|
|
|
Nigerose utilization repressor, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |