Regulon of BfrR in Lactobacillus acidophilus NCFM

Properties
Regulator type:	Transcription factor
TF locus tag:	LBA0500
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Regulog:	BfrR - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By pathway - Fructooligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 6.4 Sequence: AAATTGAAACGTTTCAAAAG Locus tag: LBA0502 Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein Locus tag: LBA0503 Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1 Locus tag: LBA0504 Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2 Locus tag: LBA0505 Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) Locus tag: LBA0506 Name: bfrH Funciton: Fructooligosaccharides ABC transporter, ATP-binding protein Locus tag: LBA0507 Name: bfrP Funciton: Predicted fructooligosaccharides phosphorylase
	LBA0502	bfrE	Fructooligosaccharides ABC transporter, substrate-binding protein
	LBA0503	bfrF	Fructooligosaccharides ABC transporter, permease protein 1
	LBA0504	bfrG	Fructooligosaccharides ABC transporter, permease protein 2
	LBA0505	bfrA	Beta-fructosidases (EC 3.2.1.26)
	LBA0506	bfrH	Fructooligosaccharides ABC transporter, ATP-binding protein
	LBA0507	bfrP	Predicted fructooligosaccharides phosphorylase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD