Profile of regulator BfrR in Lactobacillaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Regulog: | BfrR - Lactobacillaceae |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By pathway - Fructooligosaccharides utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Lactobacillus acidophilus NCFM | |||||
| LBA0502 | bfrE | -28 | 6.4 | AAATTGAAACGTTTCAAAAG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |