Regulog BfrR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By pathway - Fructooligosaccharides utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | 6 | 1 |
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| bfrE |
*
Lactobacillus acidophilus NCFM Site: position = -28 score = 6.35496 sequence = AAATTGAAACGTTTCAAAAG Gene: LBA0502: Fructooligosaccharides ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Fructooligosaccharides ABC transporter, substrate-binding protein |
| bfrF |
Gene: LBA0503: Fructooligosaccharides ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Fructooligosaccharides ABC transporter, permease protein 1 |
| bfrG |
Gene: LBA0504: Fructooligosaccharides ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Fructooligosaccharides ABC transporter, permease protein 2 |
| bfrA |
Gene: LBA0505: Beta-fructosidases (EC 3.2.1.26) |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Beta-fructosidases (EC 3.2.1.26) |
| bfrH |
Gene: LBA0506: Fructooligosaccharides ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Fructooligosaccharides ABC transporter, ATP-binding protein |
| bfrP |
Gene: LBA0507: Predicted fructooligosaccharides phosphorylase |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Predicted fructooligosaccharides phosphorylase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |