Regulon of Zur in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_0386
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 6.9 Sequence: TAAATAGTAATTATTACTCTTTA Locus tag: PEPE_0289 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: PEPE_0290 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: PEPE_0291 Name: znuB Funciton: Zinc ABC transporter, permease protein
	PEPE_0289	znuA	Zinc ABC transporter, substrate-binding protein
	PEPE_0290	znuC	Zinc ABC transporter, ATP-binding protein
	PEPE_0291	znuB	Zinc ABC transporter, permease protein
Position: -36 Score: 7.3 Sequence: TAAAACGTAATGATTACTATTTA Locus tag: PEPE_0386 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	PEPE_0386	zur	Zinc homeostasis transcriptional regulator Zur, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD